Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx for livelawnandprosper.com
Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Clutches Purses rose Tassel Female red Women Day KYS Purse Evening Wedding Fashion Ladies Beaded Bags THEwqpx

  • KYS Beaded Tassel Clutches rose Purses Fashion Female red Day Women Purse Ladies Evening Wedding Bags
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Craze For London Leather Dark Women's Tote Bags Blue Quality Faux Handbags Shoulder Large Women Bag Soft rrqpCU

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Modamoda Nappa Leather leather Black 2in1 Shoulder bag bag de Damentasche Camel ital Messengerasche NT07 rzyxq7rwEv

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Female Ladies red Bags Clutches Fashion Evening Wedding Day Women Purses Tassel KYS Beaded rose Purse Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Black Clutch Damara Party Damara Flap Womens Bag Shirred Womens Glitter Yz5qY

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your red Beaded KYS Women Clutches Tassel Day Ladies Purse Wedding Bags Purses Fashion Female Evening rose Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
GENUINE PRINT WALLET UNIQUE COBRA BI HEAD NATURAL FOLD NATURAL UNIQUE wqZxI6I