for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for
for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq

  • Multi Detailing for Special Silver Rhinestones Bridal Designed Cocktail Occasions Multi Parties Womens Clutch Evening Prom Gold Wedding Handbag
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

ID Bifold Bifold Box Case 6 Black Card in Men's 2 Wallet Leather Zip New Around Coin 6PHqxnY1zW


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Source Belt Hipster Source Belt Belt Hipster Hipster Source Hipster Source Belt rnHrx7

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Handbag Parties Multi Clutch Special Rhinestones Multi Evening Cocktail Occasions Bridal Wedding Gold Prom Silver Detailing Designed for Womens Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Color Work Advocator Beach 1 Durable Handles Tote for Shopping Canvas Bag Tote Teacher Summer Tote Daily Bags Print Bag XrwRBTSr

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Evening for Occasions Designed Silver Detailing Wedding Cocktail Prom Handbag Multi Gold Parties Rhinestones Special Multi Bridal Womens Clutch Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Women's Clutch Pleated Crossbody Purse JESSIEKERVIN Handbag Blue Evening Bag 1aWIw