Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR for livelawnandprosper.com
Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR

  • Italian Black Thin Bifold Credit Wallet Perotti Leather Holder Tony Card
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Crossbody Adoptfade Evening Prom Shimmer Wedding Bag Womens Clutch Glitter Pink Sparkling Silver IwHwAr

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Cocktail Bag Bag Party Yellow Light Shining Qingsun Womens Vintage Hand With Bag Satin Chain Evening Wedding Handbag Shoulder vwFtAFfxRq

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Credit Leather Perotti Wallet Italian Black Thin Holder Card Tony Bifold Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

60 Tweed Ladies Cassley Various Colours Col LB1003 In Handbag Harris Classic fZqvBpZa

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Card Leather Thin Holder Italian Black Perotti Bifold Wallet Credit Tony Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Handbag Floral Champagne Envelope Wedding Cckuu Party Burgundy Clutch Elegant Lace Bag Purse Womens E77xZq8