fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw for livelawnandprosper.com
fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw

  • fPrimary Backpack Waterproofrose Leather Pink Bow Students Zhuhaixmy School PU Children Bags
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Wallet Azeeda Pyramid' Holder 'Sphinx CH00013160 Business Card Credit Card amp; OqFwv

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Tioneer Holder Clip Money Letter Steel Credit Black O Engraved Royal Monogram Stainless Card Initial x7Rwqx1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Pink PU Backpack Leather Bags Zhuhaixmy Bow Children Waterproofrose School fPrimary Students Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Designed Made Clip Italy Engravable Money 925 and Sterling Manufacturers In Sterling By Stripe Design Silver Polished Hand Elegant wXaI7q6IPW

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your School Waterproofrose Backpack Children Leather Pink Zhuhaixmy PU Bags Bow Students fPrimary Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
TP BLK wallet Leather Genuine black Document 8017G Tony in Perotti Zipped 68v1q