Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ for
Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Beige Brown Florence Backpack Leather in Shoulder 2061 amp; Handcrafted Dark Italian Tan Bag Italy nx1PZwZ

  • Beige Italian Italy Shoulder amp; Tan Brown Leather Florence 2061 in Backpack Dark Handcrafted Bag
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

CH00000146 Card Azeeda Wallet Azeeda Business 'Taxi' Business 'Taxi' Credit Holder Card q7v7a


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Vintage Cavare Camel Leather RFID Brown Wallet Garzini Sleeves Card Magic 1R4nTR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Leather Bag Shoulder Tan Italy Dark amp; Brown Backpack Italian Florence Handcrafted in Beige 2061 Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

elegant Black Glitter Designer evening Bags Handbag Bridal Party Wedding Clutch Aimira SIvqwdd

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Beige 2061 Bag Italian Leather in Brown Backpack Italy Dark Handcrafted amp; Tan Florence Shoulder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Color Womens Mommy Purple Handbag Elegant Handbag up Royal Blue Rabbit Bride's Make Handbag Rhinestone Lovely Evening qxwBH7Y5xU