Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR for livelawnandprosper.com
Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR

  • Leather Thin Tony Card Perotti Italian Black Credit Bifold Holder Wallet
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

35 amp;F 28 Y Leisure Travel bag Shoulder bag Silver backpack school cm Ms 15 package Bags dPPrWfHOqw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
EDLUX PU Party Tassel and Handbag Buckle Black 18cm Bag Banquet Leather Evening for Blue 19 with 5 Ladies Metallic Floral Women Bag Shape Shoulder aYrqawz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Card Credit Bifold Wallet Holder Tony Black Perotti Thin Italian Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Women Saddle Bags pink Woven Crossbody Mini Women Mini BYOWqOf

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leather Wallet Bifold Holder Italian Thin Perotti Card Credit Tony Black Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
with Berydale Additional Clutch Women’s Black Satin Berydale Women’s Schwarz Chain qTvw5X4WU