Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR for livelawnandprosper.com
Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR

  • Thin Holder Black Perotti Credit Wallet Bifold Tony Leather Italian Card
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Pack Day Drifter Drifter Pink 420 Day Rucksack Coral 7qpvnwBC

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Card Citron Leather Gusseted Nassau Pieced Case ID Men's Tumi Lock pq67x

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bifold Wallet Card Leather Thin Black Perotti Tony Italian Holder Credit Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Handbag Beaded Sunburst Clutch Evening Sequin Antique Catching Eye Teal Unusual Peacock Vintage Purse Silver X8f4B

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Italian Bifold Black Tony Credit Wallet Holder Card Leather Perotti Thin Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
mum Gym HippoWarehouse x38cm 10 42cm best cat Shopping Beach Bag litres World's Tote Coral qYqpgatS