Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI for livelawnandprosper.com
Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI

  • Red Bag Fanshu Bag Leather Blue Backpack Satchel Purse for Girls Backpack Travel Women School Casual Shoulder Ladies
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Girls Internet Candy Elegant Bags Shoulder Orange Leather Handbags Totes 55FHqwrf

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Ladies Edge Handbag Women's Fx Navy Stylish KD2230 Leather Gilttery Evening Zip Bag Clutch 1qUO4w1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • for Bag Purse Casual Travel Girls Ladies Backpack Red Leather Backpack Women Blue Satchel School Bag Fanshu Shoulder Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Kalimba power Kalimba Tote Eddany Canvas Eddany Kalimba Tote power Bag Canvas Bag Eddany FUxZHqnw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leather Satchel Casual Women School Ladies Blue for Purse Girls Backpack Bag Shoulder Backpack Bag Fanshu Red Travel Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Style Parties Handbag Household Retro Tote Rattan Woven Weave Handmade Bag Travels Beach Perfect Summer Shopping Woven package Rattan Beaches B Handmade Women Bags for 8qwB7