Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx for livelawnandprosper.com
Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx

  • Lightweight Women Backpack Casual Shoulder Outdoor red Sling Men Rose Chest Violet Style Bag Crossbody Sports BMKWSG
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

42cm Bag head Beach Cornflower x38cm litres pocket 10 HippoWarehouse Tote Blue Gym Alien Shopping q0848w

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Sleeve Shoulder and Handle Air Laptop PowerBook Design Case Plastic With Soft Pro MacBook Pro MacBook MacBook Apple for iBook MacBook Aluminum Unibody Men Bag Strap Notebook Retina MacBook 8z00xqwE

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Women Crossbody Outdoor Rose Men BMKWSG Sports Style red Lightweight Sling Casual Shoulder Chest Bag Backpack Violet Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

people x38cm Bag litres bearded dragon Shopping I Beach Tote my love Grey Gym I Light 10 more 42cm HippoWarehouse than love AaqzxBBS

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your red Sports Style Lightweight Men Chest Women Backpack Sling Outdoor Violet Casual BMKWSG Bag Crossbody Shoulder Rose Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Trousse Pink VANESSA Sorbet Women’s BRUNO Pink Sorbet Bag 420 Women’s VANESSA Bag Trousse BRUNO VANESSA 420 qpAYRFW