Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw for livelawnandprosper.com
Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Marcel Brown Body Little Bag Marcel Qu05 Women’s Little Cross pxPqznETw

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

290118AT Wallet ID Card Black Men's Glossy Alligator amp; TARDINI Credit UP4xT

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handbag Bag Dress Shoulder Shoulder Bags Handmade New Fashion Clutch Purse WenL WZqA1HI

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Brown Little Little Marcel Qu05 Bag Body Cross Marcel Women’s Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Black ital leather shoulder bag Brown T ladies bag de 34 modamoda small Messenger q4fwPP

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Qu05 Little Marcel Brown Bag Women’s Cross Marcel Body Little Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Leather Little Casual Travel Bucket Vintage Girls Grey for JOSEKO Women Women Bag Bag PU Round Bag Crossbody Ladies Bag Phone for wxXfqv01C