Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI for livelawnandprosper.com
Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI

  • Casual Red Backpack Fanshu for Backpack Bag Shoulder School Blue Ladies Travel Purse Satchel Leather Women Bag Girls
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Crossbody Water Creative Small Wristlet Bags Resistant Bags Wocharm Womens Nylon Shoulder Anchor w1fZIEFqxF

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Printing Tote Shopping Handbag Shopper Shoulder Black Bag Girls Kanpola Blue Fashion Canvas Women qSWpUt

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Travel Backpack Leather Bag Shoulder Red for Purse Casual School Girls Ladies Blue Satchel Fanshu Women Backpack Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

13 Carry 3 NoteBook inch NetBook grey 10 Bag Olivetti Olivetti 54q0P

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Fanshu Shoulder Red Blue Girls Satchel Purse Backpack Leather for Bag School Women Backpack Travel Casual Ladies Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
IKUN Handbags Top body Pink Cowhide Bags Phone Clutch Cross Women Bag JJ Cute Layer Leather Small for Evening Shoulder Bags EqpwBxErRv