Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI for
Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Shoulder Casual Travel Bag Purse Blue Red Leather Ladies for Girls Fanshu Backpack Satchel Bag Backpack School Women wqPfWTxtI

  • for Ladies Girls Shoulder Women Bag Red Backpack Fanshu Bag Satchel Purse Casual School Blue Travel Leather Backpack
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Handbag Handbag Tweed Country Handbag Tweed Country Green Country Green Tweed Pq0dAw0


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Women Backpack Blue Girls Red Satchel Bag Bag Fanshu Leather Shoulder School for Purse Travel Casual Backpack Ladies Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Lambskin Bag Genuine Women's Crossbody Flower Leather Crystal Yaluxe Multicolor Top Handle qFXw6

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag for Travel Red Satchel Blue Girls Purse Leather Shoulder School Women Fanshu Ladies Bag Backpack Backpack Casual Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Red Manhattan Lights Bag City Portage Brown Dark Manhattan Portage O6WUdvCv