Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR for livelawnandprosper.com
Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tony Credit Perotti Leather Black Italian Bifold Card Wallet Thin Holder rWfrHFqR

  • Holder Perotti Credit Thin Tony Black Bifold Card Italian Leather Wallet
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Schranz I Idakoos chalk love Bag Tote Music style Canvas gqxHSwA

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Wedding Handbag Clutch Evening Lace Purse Black Prom Bag Handmade Party Ankoee AqXwz7x

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Black Holder Perotti Card Thin Bifold Leather Tony Wallet Credit Italian Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Wedding Evening Bag Women Prom Bag Bag Puluo Vintage Handbag Clutch Evening Bag Fasshion Beaded Day Mother's Bridal Sequin for Clutch Green Black Glitter 4PtvwqF

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leather Perotti Wallet Credit Bifold Black Italian Thin Tony Holder Card Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Party Cloth Mini Square Bag Evening Small Bag Diamond White Folding Clutch Bag JESSIEKERVIN qZYz1ERxwa