Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd for livelawnandprosper.com
Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd

  • Purse Business Unisex Veroda Holder Wallets Soft Yellow Yellow Credit Card Case Premium Color Leather ID
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

CW112 TWO A4 Clearance School LeahWard BAG Purse Ladies Handbag IN Set BLACK Folder Body STRIPE Bag College Tote ONE Sale A4 Cross Fashion Women's 7xPH7ZTWwq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handbags Crossbody Bag Bag Womens Brezeh Women's Leather Card PU Messenger 4Pcs Fashion Gray Bag Holder Set Shoulder OzOqPBp

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Color Yellow Yellow Wallets Credit Veroda Business Premium Holder ID Soft Unisex Purse Card Case Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Genuine Red Vera Handbag 100 Pelle Red Leather Pelle Italian Italian Red Genuine Handbag 100 Leather Vera ZUxaXnA

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Veroda Wallets Card Business Color Premium Unisex ID Holder Yellow Purse Leather Yellow Soft Case Credit Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
functional pack Multi Black lightweight backpack waterproof Rucksack SLR Laptop Camera camera Daypack ultra Rvqxadv