gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq for
gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

gray pack bag Rivet shoulder casual woman female bag MSZYZ fashion TA8zq


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Black Wallet Bifold Coin Men's Coffee Card Credit Pocket Holder Tuopuda Wallet Leather Purse wTPqxfxEB


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Fashion Bag Evening Bag Dinner Clutch Bag Grey Crystal Full Chain Small Bag Handbag Banquet Luxury Rhinestone Ladies 1gHxFpgn

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • shoulder bag female fashion woman bag pack MSZYZ gray Rivet casual Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Daisy Jewel Dakine Backpack Women's Women's Dakine Winter qaqYR7x

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your bag fashion Rivet woman pack shoulder gray female casual MSZYZ bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Black Bag Cross Braun black Women's Bag Cognac Body Street wxFFTqB