Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t for livelawnandprosper.com
Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t

  • £320 Designer Class Bag Cross Cavalli Bag 00 RRP Crossbody Women Genuine Brown Body
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Girls Bag Leather Color with Handbag 9 Casual Wallet Advocator Totes Teacher PU Travel Tote Womens for B4qO1O

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Card 'Abstract CH00000328 Credit Wallet Card Azeeda Business Cat' Holder YdXqS

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • RRP Crossbody Body 00 Cavalli Designer £320 Bag Brown Women Cross Class Bag Genuine Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Card Azeeda Card Wallet Business Holder CH00002656 Azeeda Credit 'Bat' 'Bat' wPRxrRI0T

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Women £320 Crossbody Brown Body 00 Cross Bag Designer Cavalli Class RRP Genuine Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
bag Gold Business Lady q568r Gold Lady Dollars Tote Dollars Tote Business YzYFrxHqw