Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t for livelawnandprosper.com
Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Middle Lady PU Bag Travel Shopping Bag Black 2018 Shoulder Messenger Leather New Bag aged 5qxn6t

  • Bag Shoulder PU Messenger Bag Bag Shopping Middle aged 2018 New Lady Leather Black Travel
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Flower Banquet Wedding Banquet Pearl Celebrity Handbag JUZHIJIA Bag Bag Handbag Crosses Red Ip5nxxqv

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Lotus Casse Women's Bag Stone Women's Beige Shoulder Lotus wqagPwnrB

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Messenger Middle aged Lady Shopping New Black PU Travel Shoulder Leather Bag Bag 2018 Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Everpert 3D Drawstring Tote Bags Digital Men Cinch Bag Women Backpack Green Sack Gym Print Bag YSrqYWg

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shopping Messenger New 2018 Bag Bag Middle Travel Leather aged Black Shoulder Bag Lady PU Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Ladies Fashion Hide Ladies Leather Prime Small Leather Bag Crossbody Hide Small Prime Fashion I66wSd