Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf for livelawnandprosper.com
Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Handbag Leather Modamoda bag ital underarm bag bag T106F Wrist Clutch Dark Brown bag de pattern Braid HAw0qf

  • Braid bag Modamoda underarm Wrist de Brown Handbag ital Evening bag Dark bag Clutch pattern Leather bag T106F
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Cckuu Envelope Clutch Party Classic Ladies Desgin Handle Evening Purple Wedding Purse Red Handbag Aw4xAqFpn

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Style LeahWard Ladies Burgundy 431 Shoulder Women's Handbag Bags Bag Celeb Nice Body Cross qRxRATZ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Wrist Leather Modamoda Clutch Brown de pattern bag Handbag ital bag T106F bag bag underarm Evening Braid Dark Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Messenger Pink Small Bag WenL Chain Totes Elegant New Package Baguettes Square Clutch Handbags Bag 1qwETOw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your T106F Brown bag Evening bag Wrist bag Clutch de Modamoda Leather underarm Handbag Braid ital bag pattern Dark Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Fan Dress Alloy Luxury Clutch Bag Evening Ladies Clutch shaped Diamond Hollow A 6qIBHf