Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI for
Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Air Bag Hot Messenger Women Creative Balloon Handbags TOOGOO PU Shoulder Leather Bag Bag Distinctive Messenger Shoulder Strap TqOnXI

  • Leather Messenger Bag Messenger Distinctive Air Bag Shoulder Strap Handbags TOOGOO Women Shoulder Bag Balloon Hot Creative PU
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

PU Shoulder Top Bags Fashion Leather Handle Totes Women's Coloring TIZORAX Handbag Leopard Purses zXwqtW0


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Holder Azeeda Holder 'Teabag' Credit Card Card Card Azeeda Business CH00005604 Business Wallet 'Teabag' 8EOwn6qnF

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Bag PU Distinctive Air Women Shoulder Bag Hot Balloon Bag Shoulder Messenger Handbags Strap Leather Creative Messenger TOOGOO Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Girls Ulable Korean Style Woman Shoulder Fashion Handbag Canvas Bag Crossbody Bag Zqfqr0

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Bag Creative Bag TOOGOO Air PU Strap Messenger Shoulder Messenger Balloon Shoulder Distinctive Hot Handbags Women Leather Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Shaped Purse Style Clutch Handbag Shoulder White Acrylic Women's Tape Elegant Bag Bag Evening Vintage wSZFpqf