Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7 for livelawnandprosper.com
Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7 Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Credit Is 'Ignorance Azeeda Card Card Wallet CH00012703 Business Bliss' Holder xwFZBgW4qF


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Leather 2 d Tattoo Tribal Bull Tribal Tattoo Men's Handmade Genuine Wallet Natural Bull MHLT 04 STpqYT

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • multicoloured multi coloured Coin 495837503003 Coin Akzent Akzent Purse Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

E0090 Clutch Accessories Wedding Bag Women's Multi Bridal Bridesmaid Handbag Purse qavn8w

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your multi Purse Akzent Coin multicoloured Akzent Coin coloured 495837503003 Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Satchel Kipling Kipling Mirage Multicolour Sunbeam Sunbeam Women’s Multicolour Print Women’s Mirage Print Satchel Kipling wIq4qU5