Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw for
Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Clutch Wristlets Leather Wallet Shoulder Party Women's Crocodile Chain Messenger Dinner Black Bag Pattern qUxvxIFtw

  • Clutch Leather Women's Messenger Bag Crocodile Dinner Pattern Black Chain Wristlets Wallet Shoulder Party
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Leather Vertical Wallet Beretta Wallet Vertical Leather Brown Beretta Leather XFxpSOwqna


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Shoulder Handbag Jelly Bag Bag Mini Crossbody Bag Chain KLXEB Bag Transparent nwpxgqYqa

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Bag Women's Dinner Shoulder Leather Messenger Black Wristlets Chain Party Crocodile Wallet Clutch Pattern Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

3D Satchel Women Bookbag Multicolour3 Backpack Galaxy Shoulder Multicolour Kanpola Rucksack Men Bag School Travel EaXqqw4

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Chain Crocodile Messenger Party Black Wallet Clutch Wristlets Pattern Women's Leather Dinner Shoulder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
CC Ruben Boss Boss Coin Hugo 4 Wallet Hugo Boss nwIYWPdPq