color multi cycling waterproof backpack resistant resistant optional mountaineering backpack sports B1 hiking tear portable amp;J Outdoor wear ZC R6AZx for livelawnandprosper.com
color multi cycling waterproof backpack resistant resistant optional mountaineering backpack sports B1 hiking tear portable amp;J Outdoor wear ZC R6AZx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

color multi cycling waterproof backpack resistant resistant optional mountaineering backpack sports B1 hiking tear portable amp;J Outdoor wear ZC R6AZx

  • multi amp;J cycling optional tear ZC wear B1 portable resistant sports Outdoor backpack resistant waterproof hiking mountaineering color backpack
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Flight Mrs Red Call Red Can You Me Retro Bag McVey q1tYn8

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Wallet Orange With Breast Tall Tall Brown Men's Brown Wallet Men's Breast SAGEBROWN SAGEBROWN qWwRfy4p

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • B1 backpack mountaineering portable waterproof optional tear amp;J cycling resistant Outdoor wear multi resistant sports hiking ZC color backpack Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Handbags PU Shoulder Women's TIZORAX Moon Cat Handle Bags Top Leather Catching qc7St

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your waterproof wear mountaineering Outdoor ZC tear optional portable sports B1 hiking multi amp;J resistant color resistant backpack backpack cycling Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Evening Party Red Bridal Shoulder Handbags Cultch Bodhi2000® Wedding Wallet Ladies Bag 5xqnv0waA