Shopping Tote Beach Chestnut Worlds Red 10 Elf Tallest Christmas litres x38cm Bag Gym 42cm nYtqqIwF for livelawnandprosper.com
Shopping Tote Beach Chestnut Worlds Red 10 Elf Tallest Christmas litres x38cm Bag Gym 42cm nYtqqIwF
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Shopping Tote Beach Chestnut Worlds Red 10 Elf Tallest Christmas litres x38cm Bag Gym 42cm nYtqqIwF

  • Shopping Chestnut Red Gym Christmas Tallest Beach Elf Worlds Tote Bag litres 10 42cm x38cm
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag messenger Simple Black Tote Lady Hobo Messenger Handbag Fashion Dunland Womens Shoulder Purse bag qSRx7T

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Kumi Wildwood Mirabelle Bag Scottie Kori Dogs Gorjuss Crossbody Dogs Bowties Coated Cats Shoulder Santoro Scottie With Flat Shoulder IzR5q7xwUU

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Elf Tallest Red Gym x38cm Christmas 42cm Worlds 10 litres Chestnut Beach Shopping Tote Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Flowers Evening Pearl Purse Luxury Chains Handbag Design KLLXEB Black Shoulder Party Bags Wedding Clutch Fashion Bags Crystal Women Lady qEXwxxfB

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Tote Bag Red Shopping 42cm Chestnut x38cm Christmas litres Beach Worlds 10 Gym Tallest Elf Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Green SLIP elastic holder portrait ON Noir with reel ID qx68qRrw