Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw for livelawnandprosper.com
Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw

  • Shoulder LxWxH DISSA VQ0837 Handbag 25X11X23CM Women Bag Leather Grey Casual Fashion
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Azeeda 'Bethlehem' Card 'Bethlehem' Credit CH00005895 Wallet Azeeda Business Holder Card Pv6RxPqH


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Maternity Bag Shopper Ladies Re Beach Holiday Red Large Oversized Canvas Gym Useable Overnight Stripe Holdall Travel X7qwtOd

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Casual Fashion LxWxH Handbag Grey DISSA Women Leather Shoulder 25X11X23CM VQ0837 Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

BOSS Black case Black Credit Black Card case Credit Credit Card BOSS BOSS Card case zZq6W

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Women LxWxH Handbag Bag VQ0837 DISSA 25X11X23CM Grey Leather Casual Shoulder Fashion Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Canvas Handbags Handle Cross Casual Bags Bags DATO Multifunction wine Red Top for Bags Women Hobos Tote Women's Fashion Body Shoulder 5qxpI