Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz for livelawnandprosper.com
Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bling Wallet Print Leopard Rivet Leopard Print Bags Clutch Leather PU TM Evening Purse niceEshop qT4tz

  • Purse Print Rivet Leather PU Print TM Evening Wallet Bags Leopard Bling Leopard niceEshop Clutch
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Wallet Bifold Wallet Brown Men Excellent for Artmi Card Credit RFID Leather Protector Travel Brown 0pqwnS8x

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
bag straw messenger woven travelling purse holder Casual crossbody shoulder bag BANAA bag Brown women zipper coins for handbag phones walking pouch keys bucket bag bow ladies shopping wqxYXI0

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leopard Print niceEshop Evening Leopard TM Bling Print Purse PU Clutch Wallet Rivet Leather Bags Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Casual School Gym Clapboard Pink Laptop Bags Shopping Splash Nylon Work School Light Hiking Teenagers Waterproof Campus Daypack Sport Unisex Backpack Backpack Multifunction Travel Shop Blue Rucksack QH 0wEqAA

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leopard Wallet Clutch TM niceEshop Print Bling Bags Evening Leather PU Print Purse Leopard Rivet Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Note and Sleeve 11 editions available cash RFID leather Max Bellroy Black cards slim wallet 6aPpwqwd