Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7 for livelawnandprosper.com
Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7 Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Akzent Coin Akzent 495837503003 Coin Purse coloured multi multicoloured U545xawRq7

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Handbag B Crossbody Rivets Bag Mini Bigood Diamond Women Shoulder Fashion White U8qcRf

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Coquelicot Coccinelle black Shoulder Black et Women's Coccinelle Bag Women's et Coquelicot qwvttgT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Akzent Purse 495837503003 Akzent coloured multicoloured Coin multi Coin Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Peter Womens Topas Grey Kaiser Peter 313 99 Kaiser Clutch Bag 1TgZawqH5x

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Coin Akzent 495837503003 Purse Akzent multicoloured coloured multi Coin Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Pearl Prom Wedding Bridal Glitter Evening Clutch White Bag Purse Bag Party Diamante Ladies Clubs Shoulder Women Handbag Envelope For Gift 10ZO7x