Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w for livelawnandprosper.com
Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Bag JESSIEKERVIN Handbag Women's Clutch Pleated Evening Blue Crossbody 0qX4w

  • Blue Women's Purse Bag Clutch Crossbody Handbag JESSIEKERVIN Pleated Evening
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Wallet JAGENIE Red Handbag Women Royalblue Purse Coin New Embroidered Bag Flower Satin Silk Gift Small 446R8wqx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Tote Color Solid Women Oce180anYLV Single Travel Fashion Pink Bag Pouch Shoulder Handbag Party tItaw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Clutch Handbag Crossbody Pleated Purse Women's Evening Blue Bag JESSIEKERVIN Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Women's American Diagonal Brown DYYTR Three Shoulder Bills Ladies' Fashion And Piece Bag European dqxwIT

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your JESSIEKERVIN Handbag Bag Pleated Women's Crossbody Purse Blue Evening Clutch Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Geometry Bag MyDaily All Mystic Canvas Seeing Handbag Shoulder Womens Eye Tote wgqrxXqO