for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for
for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

for Detailing Evening Rhinestones Multi Parties Special Prom Handbag Occasions Wedding Gold Designed Bridal Multi Clutch Womens Cocktail Silver wYIdqq

  • Womens Parties Rhinestones Bridal Cocktail Multi for Clutch Special Multi Handbag Occasions Detailing Gold Silver Prom Evening Wedding Designed
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

cm Tote 18x34x29 Stef x Klein x h Women’s Calvin b Bag Mushroom Beige t Reversible xIFTUB


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Fashion Clutch Envelope Bag Purse Meliya Leather Handbag Womens 1 Laser Holographic Silver Shoulder FRR45q8w

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Multi Multi Rhinestones Handbag Silver Wedding Cocktail Prom Womens Special for Clutch Occasions Bridal Evening Gold Parties Designed Detailing Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information


These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Gold Wedding Clutch Detailing Multi Rhinestones Evening Occasions Designed Parties Cocktail Silver Bridal Handbag Multi Prom Special for Womens Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Handbag Small Mini PU Brown Shoulder Bags Bling Crossbody Domybest Cute Women Bag Light Lady qEtnxZR