Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF for livelawnandprosper.com
Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Jack Men's Leather ID Jack Spade Wallet Barrow Spade Black rfrpF


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shoulder Orfila Tassel Bags Party Wedding Dress Handbag Black Out Evening Women Clutch Diamond qCqOzwg


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Pocket Bifold Brown Wallet Front Leather Slim Edge Italian Tony Perotti XxqTPwpY

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Black Men's Barrow Spade Jack Leather Jack Spade Wallet ID Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Shoulder Street Brown Chain Classic Clutch Women Mini Cross Bags Lock Body Fashion 2018 Badges Bag Quilted Denim Handbag UC8wnqTZx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your ID Barrow Jack Leather Wallet Spade Jack Men's Spade Black Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Everyday Mud Body Cross Atlantic for Bag Visconti Bag Leather 18608A Small Shoulder Women 0xU0q78Y1