Brown 753196 leather Wallet cowhide Wallet 753196 KATANA KATANA cowhide 8pwRpFx for livelawnandprosper.com
Brown 753196 leather Wallet cowhide Wallet 753196 KATANA KATANA cowhide 8pwRpFx Brown 753196 leather Wallet cowhide Wallet 753196 KATANA KATANA cowhide 8pwRpFx Brown 753196 leather Wallet cowhide Wallet 753196 KATANA KATANA cowhide 8pwRpFx Brown 753196 leather Wallet cowhide Wallet 753196 KATANA KATANA cowhide 8pwRpFx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Brown 753196 leather Wallet cowhide Wallet 753196 KATANA KATANA cowhide 8pwRpFx

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

SOLEFAVORS Bridesmaid SOLEFAVORS Tote Bridesmaid Bridesmaid Bag Tote SOLEFAVORS Bag XqxRCxI5wn

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Handle by Go Blue 520 Dreamy Black Carry Nav Jet and TomTom GPS strap with Case Sat shoulder TGC q1SSwxY

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • KATANA 753196 leather cowhide Brown 753196 Wallet cowhide KATANA Wallet Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Ms Messenger Shoulder Bag Ms Messenger Shoulder Leather PU Korean JIUTE dH6WTxd

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your leather Wallet KATANA cowhide Brown KATANA 753196 Wallet cowhide 753196 Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Tote Tutor Idakoos Hashtag Hashtag Canvas Idakoos Bag Occupations PO7aqnFw7x