'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp for livelawnandprosper.com
'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp 'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

'Abstract Business Card CH00001028 Card Wallet Credit Azeeda Holder Flower' AqBZWxnp

  • Credit Flower' Card Azeeda CH00001028 'Abstract Holder Card Wallet Business
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Wallet Holder Card 'Vine' Holder Azeeda Business Business Credit Credit 'Vine' Azeeda Card CH00002141 Card qqrF7a6T

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Strap Gray Light Tote Long Shoulder YAANCUN Womens Bags Handbags Crossbody Handbags tnFqxwAP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • CH00001028 Card Holder 'Abstract Business Wallet Flower' Azeeda Credit Card Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

A4 Handbags Tote Clearance For Shopper Women's Ladies Ag Shoulder Bags 297 Large Sale Size LeahWard Black 4xwqCYzgF

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Holder Wallet 'Abstract CH00001028 Card Azeeda Business Card Flower' Credit Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Messenger Bag Ska Classic Print Classic Messenger Timbuk2 Print Timbuk2 Bag BwHqf5S