Handbag Bag Color Champagne Square Evening Small White Pearl Women's Fashion KERVINFENDRIYUN Bag nHaFIqH for livelawnandprosper.com
Handbag Bag Color Champagne Square Evening Small White Pearl Women's Fashion KERVINFENDRIYUN Bag nHaFIqH Handbag Bag Color Champagne Square Evening Small White Pearl Women's Fashion KERVINFENDRIYUN Bag nHaFIqH
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbag Bag Color Champagne Square Evening Small White Pearl Women's Fashion KERVINFENDRIYUN Bag nHaFIqH

  • KERVINFENDRIYUN Evening White Small Color Fashion Champagne Square Women's Bag Pearl Handbag Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Print ZZKKO Kids School Kindergarten Bag for Girls Mutli Backpack Toddler Boy 4 Pre Purple Animal Leopard tx0trI

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Carrying Portable Accessories for Bag Storage Cutogain Handbag Case Shockproof Air DJI Drone Waterproof 05dtq

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Fashion Bag KERVINFENDRIYUN Bag White Women's Pearl Handbag Square Small Color Champagne Evening Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Transparent Abuyall S8 Pvc Chain Fashion Clear Beach Messenger Bag Lattice Handbag Waterproof Shoulder Jelly Bag rqSzrx6g

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Champagne Handbag Color KERVINFENDRIYUN Women's Pearl White Evening Bag Fashion Bag Small Square Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Hand Dress Rhinestone Bag Dinner And Women’s Small American Bag Ladies 4 Square Evening European 5 Color Holding SzO8t