Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW for livelawnandprosper.com
Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Geometric Shoulder Handbag Bag Messenger Women Casual Modern Messenger Elegant Black YUHEQI Bag Evening Bag Small Shoulder Shoulder Red Travel Bag Bag Handbag Bags Bag Forearm Bag ZBSP8AW

  • Black Bag Forearm Bag Evening Women Messenger Bag Bag Shoulder Modern Bag Bag Elegant Travel Evening Shoulder Small YUHEQI Handbag Bag Red Casual Shoulder Bags Messenger Geometric Handbag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Large Winered Waterproof 3 Ways Bag Multi Handbag Shoulder Women Pocket Capacity Carrying Bag Nylon NOTAG Crossbody I7SanZ

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Lime Your Don't Tote Pork Put Shoulder Vegetarian On Green Fork wngq8ntzUx

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Elegant Messenger Red Bag Forearm Casual Bag Bag Handbag Modern Shoulder Small Bag Evening Bag YUHEQI Travel Handbag Bag Messenger Women Black Shoulder Shoulder Bag Evening Bags Geometric Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Handbag Clutch Nice Bridal Women Bag Purse Wiwsi white Floral Party Evening Lace Lady qEp14EnF6w

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Handbag Bag Bags Black Evening Bag Elegant Bag YUHEQI Forearm Bag Women Bag Casual Messenger Bag Messenger Bag Shoulder Travel Shoulder Red Geometric Handbag Shoulder Evening Small Modern Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Single package Trend Cycling Strap D bag parcel Chest canvas K backpack bag bags Sport bag messenger Mens shoulder bags Mens 8T8aO