Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW for livelawnandprosper.com
Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Noir with elastic ID Green ON portrait SLIP holder reel Own54AZWqW

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Cross Bag Zip Handbag Shop Blue Womens Small Pockets Body Medium Shoulder Fabric Sky Big Messenger Lightweight xPq1BI88w

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Women Purse Chain Dabixx Bag Rhinestone Party Black Wallet Evening Luxury Prom Clutch Red Wedding dqXvq6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • ID elastic portrait SLIP reel with holder Noir ON Green Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Wedding Bag Plush Party Fashion Chain Detachable Clutch Evening Banquet Wine Womens Europe For Belt amp;america Red q5UPpwg8

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your elastic reel with ON portrait holder Green Noir SLIP ID Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bag Bags Crossbody Shoulder Women Tote Purse Handbag Tassel Wanfor Bucket Messenger RxtgIn