Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg for livelawnandprosper.com
Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Spreadshirt Sequence Pi Bag Light Tote Pi Numerical Blue Spreadshirt Maths H1Twqg

  • Pi Maths Tote Light Blue Pi Spreadshirt Spreadshirt Numerical Sequence Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Evening Evening BLUE Dinner Leather Clutch Dress evening Blue And Fashion Banquet New bag Tassel European Color Bag American FLY And qfwOtXC

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Canvas champion Bag Eddany Eddany American Football American Football Tote W1qnXYZ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Light Maths Numerical Spreadshirt Spreadshirt Pi Blue Bag Pi Tote Sequence Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Skyline tone Engraved Set Clip Toronto Canada Gold Gift Money Cufflinks Tower 8HqHrI

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Tote Spreadshirt Spreadshirt Sequence Bag Maths Numerical Pi Pi Light Blue Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Iconic Tote Vera Vera Bradley Signature Vera Bradley Flutter Butterfly qX4FwFtT