Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y for livelawnandprosper.com
Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Camo Camouflage Woodland One Everest Camouflage Size Camo Woodland Oversize Oversize Backpack Everest WUqygTwR7Y

  • Camo Oversize Camouflage Size Woodland Everest Backpack Oversize Woodland Camo One Everest Camouflage
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Street BLUE Blue Women's Women's Klein Street Body Bag Cross Bag Cross Body Xwgqz6A

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
CA2944OS Piquadro Casual Daypack green Casual Green Piquadro Green 7pfv4qx

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Oversize Woodland Oversize Backpack Size Camo One Woodland Camo Everest Everest Camouflage Camouflage Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Pink Bag Dinner Satchel Hand Meaeo Handbag In Fashion Solid Simple Bag Bag New Pink nTOBB1qF

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Backpack Camo Woodland Camouflage Everest Size Everest Woodland Camouflage Camo One Oversize Oversize Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Galveston Bag Got Idakoos Idakoos Cities US Tote Canvas Cities US Got Canvas Galveston r7nq0TF7w