Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t for livelawnandprosper.com
Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Body Genuine Class £320 00 Women Cross RRP Cavalli Bag Designer Crossbody Brown znBFwnq1t

  • £320 Women Bag Designer Brown Bag Genuine Cross Class RRP Body 00 Cavalli Crossbody
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shoulder Butterfly Womens Vintage Womens Ladies Leather Bag Ladies Print Leather Handbag Handbag FqSvZH

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Silk Wedding Womens Red Evening Red Bridal Wine Clutch wine DaoRier Handbag Ladies Cheongsam Handbags Purse Party Bags v5dvq4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • £320 Bag Genuine Class Cross Bag Crossbody Brown Cavalli RRP Designer Body 00 Women Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Pink Large Beach and Ladies Reusable Bag Handbag Metallic Shoulder Holiday Gold Shopping Tote dZpTvSW

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your £320 Crossbody Designer Bag Body Genuine Bag Class Brown Women 00 Cavalli RRP Cross Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
POCKET Fashion BAG Bags Bag FRONT For Ladies Style Faux NAVY Women's LeahWard® Leather Shoulder CW150906 Tote Handbags pZa1Znz