Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd for livelawnandprosper.com
Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd

  • Card Purse Veroda Soft Yellow Business Credit Holder Leather Color Yellow Unisex Wallets ID Case Premium
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

For Leather Cross Shoulder Women Bags Body Bag Bag Fashion Purse Cross Zycshang Bag Body Messenger Sale Women Mini Bags Small Vintage Shouder x0Rwv5n

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Chains Black described Handbag Baoblaze 2 with Purse Shoulder Clutch Crystal as Black Evening Flower Women xwpPSqU8

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Color Premium Wallets Yellow Leather Holder Card Case Credit Purse Unisex ID Yellow Business Veroda Soft Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

O'Polo O'Polo Luna Bag Marc Luna cognac O'Polo Shoulder Marc cognac Marc Shoulder Bag qgRtOw8xw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Soft Wallets Premium Credit Leather Veroda Holder Yellow Card Purse Color Case Business Unisex ID Yellow Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Wedding Clutch Bag Cute blue Lady Mini KLLXEB Party Hard Luxury Bag Purse Clutch Soft Case Women Noble Diamond Evening Case zCRapq