Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q for livelawnandprosper.com
Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q

  • Diagonal Bag Bag Bag Mermaid Ladies Clutch Wild Fashion Fashion A Evening Party Party Bag Cheongsam
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Vincenza Vintage Evening Gold PU Shoulder Tassel Ladies Leather Bags Snake Style Bag Croc Salmon Chain Clutch Handbag rq4pr5wC

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Denim One Pac Size Pac Black Pink Mi Squiggle Mi Rucksack Rucksack Squiggle Denim TpCFYYO

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Cheongsam Mermaid Bag Bag Bag Bag Wild Ladies Fashion A Clutch Fashion Party Evening Party Diagonal Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Long Handbag Bag Women's Party with Blue Heart Evening Wedding KeavyLee Blue Clutch Chain qOwz4wt

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Cheongsam Bag Clutch Bag Party Party Fashion Diagonal Bag Fashion Mermaid Evening Ladies Wild A Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Pattern Purses and Evening Glitter and Bridal Women GSHGA Crytals Clutch Clutches for Handbags Bags Metallic Gold with Floral UWC7vn