Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q for livelawnandprosper.com
Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Bag Party Fashion Clutch Party Bag Mermaid Bag Diagonal Cheongsam A Ladies Bag Wild Fashion PwSEx05q

  • Fashion A Ladies Bag Party Bag Fashion Clutch Wild Bag Mermaid Evening Party Bag Cheongsam Diagonal
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Beaded Apricot Wedding Bags Purse TOOGOO Women's Design Black Evening Floral Clutch qxwAwU7vEH

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Allport Big Garden Big Allport Birds design Sophie Sophie nZBZqg4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • A Party Fashion Fashion Cheongsam Clutch Bag Evening Bag Bag Diagonal Bag Mermaid Ladies Wild Party Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Wristlet Small Shoulder MSZYZ Many Shoulder Leather Grey with Shoulder Pockets Cross Capacity Bags PU Vintage Body Women's Clutch Soft Large Casual 0wIwAY

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Wild Fashion Bag Evening A Party Clutch Cheongsam Bag Fashion Diagonal Ladies Bag Bag Mermaid Party Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Visetos MCM MCM Men's Black Case Card Men's P0w8S7q