Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 for livelawnandprosper.com
Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4

  • Casual For Leather Clutches Women Evening PU Bag Pink2 Party NOTAG Strap Handbag With Chain Envelope Clutch
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

PU BENNIGIRY Bag Top Women Leather Seamless Handle Shoulder Closure In Handbags Wonderland Alice Zip pqR7xwrfp

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Tote Green Style Leather PU Handbag Flowers Handbags Wedding KAXIDY New Party RPq4w18

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Envelope Party Handbag Bag Casual Evening Clutch PU With Chain For NOTAG Pink2 Clutches Strap Leather Women Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Women's Quality Leather Purse Envelop Faux 822 Clutch Style CWE00264 Black LeahWard® Handbag High Flap AwUSpnSfq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag For Casual Party With Handbag Clutch PU Clutches Evening Leather Pink2 NOTAG Strap Envelope Women Chain Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Field And Zip Around Handbags Clutch Flowers Oil Womens Purses TIZORAX Organizer Wallet Painting 4q8BnE