Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw for livelawnandprosper.com
Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw

  • Big Bucket Bag Women Leather High Shoulder Handbag Bag Solid Gray Quality Aediea
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Messenger Dogs Country Country Wide Messenger Beige Dogs Wide Bag Messenger Beige Wide Country Eqx8Pw7

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Satchel FURLA Acero FURLA Women’s Cookie Beige Candy Small Satchel Women’s HFwq01x

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • High Handbag Bucket Big Gray Leather Women Solid Shoulder Aediea Quality Bag Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Ladies Envelope Women's Clutch Bag Black Diamante Designer Evening Handbag Purse Satin KY2207 Rq4HRr

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Women Handbag High Bucket Bag Bag Leather Aediea Gray Quality Solid Big Shoulder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bag Jelly Waist Bag Bum Beach Ladies Travel Fanny Hip Pack Shoulder Pack Bags Waterproof White Fashion Laser Waist Chest Bag Bumbag Zipper Sling wvq1pvI