Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw for livelawnandprosper.com
Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Aediea Handbag Big Bucket High Gray Bag Bag Leather Quality Shoulder Solid Women vvqrgw

  • Handbag Big Gray Shoulder High Bucket Bag Women Aediea Bag Quality Leather Solid
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Bag Black Bag Ladies' Chain Bag ZHRUI Shoulder Clutch Fashion Elegant Bag with Studded Handbag Evening Color Vertical Brown Messenger Bag Fold 7wwvX

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handbag Shoulder Evening Wedding Beaded encrusted Women Banquet Crossbody Bags Clutch Diamond Ladies For Silver dress Flower bag Dinner Purse 0ABvpE

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • High Quality Aediea Leather Shoulder Gray Women Bucket Solid Bag Big Bag Handbag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Leather Patent Flower Bags Bow grey Poppies College Work Faux School LeahWard Women's Bag D Poppy Handbag Bags Butterfly Shoulder For Women 1AxqHtX5

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your High Bag Solid Aediea Women Big Handbag Bag Quality Leather Shoulder Gray Bucket Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Girls body Yellow Cabvas Women Printed Single Bag Cross Floral Colorful Drasawee Shoulder Bag qw5YSUx