'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd for livelawnandprosper.com
'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd 'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd

  • 'Polar Credit CH00006069 Card Holder Playing' Azeeda Wallet Bears Card Business
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Xardi Leather Handbag Faux Bag Party Evening Flat Medium Black Wedding Clutch Metallic London Women pxfpUwAq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Blue No'Dae Beach Gonnae HippoWarehouse 10 Gym Shopping Tote That Bag Cornflower litres 42cm x38cm n1OCxw4qC

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Card Azeeda Bears 'Polar Wallet Holder Card Playing' Business CH00006069 Credit Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag B Bag Ladies Shoulder Vintage Bags Handbag Travel Casual Crossbody Messenger w4CFqU

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bears Holder Playing' Wallet Card Azeeda Card Business Credit 'Polar CH00006069 Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Casual Shoulder Solid black2 Soft Handle Women Metal Ladies Handbag Sac Women Tote Bag Pin Leather Pu Fashion Type Bag Bag wOPTHqn