'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd for livelawnandprosper.com
'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd 'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

'Polar Card Playing' Bears Business Credit Holder Azeeda CH00006069 Card Wallet dw6IBqd

  • CH00006069 'Polar Business Azeeda Playing' Credit Card Card Bears Holder Wallet
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Clutch Zip Around Wallet Head Handbags Womens Organizer TIZORAX Purses And Stylized Lion PZIvz

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Azeeda Credit CH00000789 Wallet Business The 'Jack Holder Card Box' in Card xxPr0

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Card 'Polar Business Playing' Bears Wallet Azeeda Card Holder Credit CH00006069 Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Leather Blocking Genuine Scan Proof Men'S Signal Trifold Rfid Brown Wallet wqpWcaEF

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bears Holder Playing' Credit Wallet 'Polar Business Card Card Azeeda CH00006069 Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Clip 925 Sterling Silver Money Dollar Sterling Sign Silver 925 6BwSf8q