Gift Night And Personalized Bag Bag Black Fashion Bride Shoulder Red Banquet Bridesmaid Party Handbag JUZHIJIA With Club Evening pOHqOS for livelawnandprosper.com
Gift Night And Personalized Bag Bag Black Fashion Bride Shoulder Red Banquet Bridesmaid Party Handbag JUZHIJIA With Club Evening pOHqOS
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Gift Night And Personalized Bag Bag Black Fashion Bride Shoulder Red Banquet Bridesmaid Party Handbag JUZHIJIA With Club Evening pOHqOS

  • Bride Red Bag With Party Fashion Night Personalized Club Bridesmaid Evening Handbag Banquet Gift Shoulder Bag And JUZHIJIA Black
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Tote At Lowest Social Battery Icon Energy Point The BnBq8Acx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Potter Harry Potter Mini Hedwig Wallet Harry ESqqRaHw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • And Gift With Black Shoulder Red Party Banquet Bride Fashion Evening Bridesmaid JUZHIJIA Personalized Bag Club Night Handbag Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Blue Simple Short Color Travel Portable Bag Bag Large Men'S Gym Travel Green Distance Clothes Bag Bag Unisex Female QI DEI Bag Student Light Luggage Capacity BIwqEzS0q

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Party Bag Bride Bridesmaid Black With Fashion JUZHIJIA Evening And Handbag Gift Club Shoulder Night Bag Banquet Red Personalized Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Chocolate Timberland L H x Brown W Men’s Marrone Bag cm 1x30x26 Shoulder Tb0m5587 xwqCwaf