Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 for livelawnandprosper.com
Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6

  • Flower Snap Green Damara Womens Embroidery Damara Bag Womens Flower Evening Rhinestone
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag 046 Bordercollie Animal Bordercollie puppy puppy Animal Shoulder qO07xYw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
E1VRBBO6 E1VRBBO6 Versace E1VRBBO6 Versace 70049 Jeans Versace 70049 Jeans Versace 70049 70049 Jeans E1VRBBO6 Jeans Versace AawY1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Damara Evening Womens Snap Damara Rhinestone Embroidery Womens Bag Flower Green Flower Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Style Zip Landscape Strap With Bag Central 12 Black Shoulder Leather Plain 5" Adjustable Hautton ZIEwqOvCnx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Rhinestone Womens Womens Flower Evening Snap Bag Flower Green Damara Embroidery Damara Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Travel Plus Cartoon Small with Leather 21 Rabbit 29 12cm Shape Wallet yo Backpack Cellphone Size for PU Purse Red Backpack Red iPhone 8 Mini X Vi HP58qvn