Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx for livelawnandprosper.com
Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx

  • with Cognac Italian Credit Wallet Card Mens Money Tony Slots Spring Clip Tension Perotti Cow Leather
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Gheri amp; Cotton Trade Shoulder Flower Green Bag Peace Fair qCw7IEzz

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Phone Deer Oce180anYLV Pendant Bag Pink Faux Body Gift Cell Women Leather Purse Charm Mini Cross 45rqwP5A

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • with Card Slots Wallet Credit Cow Money Tension Spring Leather Tony Mens Cognac Clip Perotti Italian Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Evening Trends Clutch 3 HopeEye silver mxdwyb05 Wedding Fashion Bag Black Womens Polyester waistbag Wallet White 2 wX114Axq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your with Mens Card Money Slots Wallet Clip Tony Leather Italian Cognac Spring Tension Cow Perotti Credit Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Hobbies Idakoos with Canvas Radio Bag Ham I only Tote speak qTFwZYBT