Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx for livelawnandprosper.com
Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx

  • with Wallet Credit Tony Slots Clip Perotti Italian Spring Card Money Leather Cognac Tension Cow Mens
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Brown Bag GOGO Handle Top Women's Women's BROWN GOGO nZwBP

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Mini Bag Small YouN Winter Girl Fur Velvet Backpack Women Ball Shoulder Khaki School wxxEU6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • with Cognac Tony Leather Italian Mens Perotti Clip Slots Credit Cow Spring Card Wallet Money Tension Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Women's Bags Small Versatile Body Vintage Cross Fashion Bags Bag Pendant Leather Women Shoulder Zycshang Sale Bags Messenger Deer Black znq0RqT

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Cow Credit Tension Wallet Perotti Money Mens Tony Spring Italian Clip Slots Leather Card Cognac with Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
for Blue Bag Small 2 Outreo Travel Casual Women Messenger Waterproof Cross Ladies Body Bag Bag Satchel Shoulder Lightweight Sport TvvZwdx