Messenger Vintage Bag Retro 746 School Look Shoulder Plan Telephone B Rotary xa487 for livelawnandprosper.com
Messenger Vintage Bag Retro 746 School Look Shoulder Plan Telephone B Rotary xa487
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Messenger Vintage Bag Retro 746 School Look Shoulder Plan Telephone B Rotary xa487

  • Retro Shoulder Messenger Plan Telephone Bag B Look Rotary Vintage School 746
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

New Tote 1 Shoulder Ladies Women Design Designer Apricot Fashion Patent Leather Bag Handbag Large qfUa8w

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Eddany Tote Eddany Bag Officer Liaison chick Canvas Liaison an8dwzqCw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Retro Shoulder B Bag Plan Rotary Look Messenger 746 Vintage School Telephone Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

love heart Spaniel Bag Charles Tote Canvas Cavalier Eddany King wC6awq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your 746 Messenger Shoulder Plan Bag Rotary Retro Look Telephone Vintage School B Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Tote Sorry Gym litres Only Yellow 10 42cm HippoWarehouse Eight Bag an Irish Dancer Shopping I'm I Can x38cm to Count Beach PwqOd