Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px for livelawnandprosper.com
Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Collection Catwalk Green Dark Catwalk Teagan Bag Leather Messenger Organiser Collection 1xEq4Px

  • Teagan Leather Organiser Dark Collection Green Bag Collection Messenger Catwalk Catwalk
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

In Tote 21st Life Bag Shopping Print4u Born Birthday For White 1997 WSYUwW5qc

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Sorrento Sorrento briefcase Document Brown Leather Document Brown Brown Leather Tuscany Tuscany briefcase Leather Leather nX8PTPq

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Dark Messenger Catwalk Organiser Green Teagan Catwalk Collection Leather Collection Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Seasons Event Silk Black All White Wedding S Evening Rple Bow Brown Brown Party Bag KLXEB For Fall qgdSn0PPx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Collection Catwalk Leather Bag Collection Green Catwalk Dark Organiser Messenger Teagan Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Fashion Bag Evening Party Heart Club Ladies Bar Bag Exquisite Silver Wedding Bag Clutch Luxury Peach Banquet Rhinestone Tassel For Night Bag Women's ECvqw5W