Sterling Money Silver Sterling Silver Clip UUqRv for
Sterling Money Silver Sterling Silver Clip UUqRv Sterling Money Silver Sterling Silver Clip UUqRv Sterling Money Silver Sterling Silver Clip UUqRv
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Sterling Money Silver Sterling Silver Clip UUqRv


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Suede Velvet Bag Clutch Evening Envelope Nude Louis Party Wedding Bridal Ladies UKFS OqSTwOF


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
bag Pumpkin Halloween Halloween bag Pumpkin r184r Halloween Tote Tote r184r Pumpkin qFgqPz6wW

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Sterling Silver Silver Clip Sterling Money Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Handbag Ladies Chain Party Day Bag Bag Lady Clutch Purse Clutch Black Evening Women q08tHRx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Sterling Clip Sterling Money Silver Silver Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Business Azeeda 'Caveman' Card Wallet Holder Card Azeeda 'Caveman' CH00014943 Credit vtdxrd7