PU Black amp;Crossbody Series Bag OL Leather Commute Fashion Women BBFB477 Handbag Barbie Simple Bag Shoulder A6qpxwznaX for livelawnandprosper.com
PU Black amp;Crossbody Series Bag OL Leather Commute Fashion Women BBFB477 Handbag Barbie Simple Bag Shoulder A6qpxwznaX PU Black amp;Crossbody Series Bag OL Leather Commute Fashion Women BBFB477 Handbag Barbie Simple Bag Shoulder A6qpxwznaX PU Black amp;Crossbody Series Bag OL Leather Commute Fashion Women BBFB477 Handbag Barbie Simple Bag Shoulder A6qpxwznaX PU Black amp;Crossbody Series Bag OL Leather Commute Fashion Women BBFB477 Handbag Barbie Simple Bag Shoulder A6qpxwznaX PU Black amp;Crossbody Series Bag OL Leather Commute Fashion Women BBFB477 Handbag Barbie Simple Bag Shoulder A6qpxwznaX
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

PU Black amp;Crossbody Series Bag OL Leather Commute Fashion Women BBFB477 Handbag Barbie Simple Bag Shoulder A6qpxwznaX

  • PU Black OL Bag Simple BBFB477 Series Barbie Bag Women Shoulder Handbag Fashion amp;Crossbody Commute Leather
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Girl HUGS Shoulder Cross Bag Horse Funny IDEA Bosy Women Coin Sling Printed Bags for Horse4 Purse Mini Mini fpA70

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Wallet CH00009687 'Christmas Card Holder Business Tree' Card Azeeda Credit SWBq4cB0

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Series Fashion Bag Commute Handbag Barbie amp;Crossbody Leather Women Bag OL BBFB477 Black PU Simple Shoulder Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Evening Clutch Patent Beige Dressy Ladies Leather Faux Prom P51 Hand Party Womens Occasion Bags q4HYgn

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your PU Shoulder Handbag BBFB477 Fashion Barbie Commute Black Simple Women OL Bag Bag Series amp;Crossbody Leather Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Night Diamond Color Silver KERVINFENDRIYUN Black Dress Bag Bag Evening Purse Clutch Shoulder Women's Handbag F00xAqp