Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x for livelawnandprosper.com
Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

'Wooden Wallet Card Business Holder Azeeda Sled' Credit CH00005969 Card Hdq0w

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Shoulder Ladies Handle Of JSTEL Women Patern Statue New Top Bags Tote Handbag York City Liberty Large wqfwXHxABF

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Geology CafePress Cloth Shopping Canvas Natural Peace Bag Bag Love Tote Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Top C L Women's Bag barock 30 Reisenthel Handle Liter black taupe Allrounder w5Xq0aa

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Geology Peace CafePress Bag Love Cloth Canvas Shopping Natural Tote Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
to Teenager's up for Blackfit8 15 6'' amp; Backpack Grey Laptops Black Official YxYIwqzf