Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x for livelawnandprosper.com
Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Genuine 35x28x16cm by and shoulder Bag Brick Elegant Woman Italy in leather Beige Made Satchel CTM with strap handles n1qxaPPw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Slots Genuine Capacity Wallet Card Collection 16 Men Plume Card ~ Credit in Protector Leather DV Multi brown Bart for Dark 0Xxqz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Love Tote Cloth Canvas Shopping CafePress Bag Peace Natural Geology Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Holder Card 'Mum Azeeda Card CH00003858 Bunting' Wallet Credit Business RIvxFq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Peace Shopping CafePress Love Bag Cloth Geology Canvas Natural Bag Tote Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bag For Flower Bag Cosmetic Crossbody Party Silver Gold Bag Wedding Shoulder For Bag Wallet GXYCP Women Clutch Evening SZ55qWAn