Shoulder Bag Bag Messenger around Boston Zip Sunbobo Bag Brown Simple Retro Leather x74wn6gq0 for
Shoulder Bag Bag Messenger around Boston Zip Sunbobo Bag Brown Simple Retro Leather x74wn6gq0 Shoulder Bag Bag Messenger around Boston Zip Sunbobo Bag Brown Simple Retro Leather x74wn6gq0 Shoulder Bag Bag Messenger around Boston Zip Sunbobo Bag Brown Simple Retro Leather x74wn6gq0
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Shoulder Bag Bag Messenger around Boston Zip Sunbobo Bag Brown Simple Retro Leather x74wn6gq0

  • Retro Leather Brown Boston around Bag Shoulder Zip Bag Bag Messenger Simple Sunbobo
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Cm3718 Cm3718 Black Black Shoulder David Bag Women's Jones Shoulder David Jones Cm3718 Women's 1rgwrE


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
And Handbags Flower Ladybugs Around Zip Organizer Colorful Womens Purses TIZORAX 1 Pattern Clutch Wallet xW0RqUA8nw

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Bag Sunbobo Leather Brown Bag Zip Messenger Bag around Simple Boston Shoulder Retro Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

rabbit Multi Wallet Long Zipper Strap Long With function Lovely Leather Classic Yellow Wrist Color Orange Purse Casual Women's Clutch Simple d7qAFWvw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Zip Simple around Sunbobo Retro Brown Leather Shoulder Bag Bag Bag Boston Messenger Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Tundra Polar Truly Bear Canadian Men's Wallet on Billfold Teague wZZ7I8q