Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x for livelawnandprosper.com
Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x

  • Ladies Stripe Bags BagsWomen Tote Handbag Bag Handbags Shoulder Women Leather
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Women Purse For Shoulder Gift Prom Handbag Blue Wedding Clubs Bag Woven Evening Party Bridal Clutch Bag Ladies FS1BrqF

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Baker bordeaux Bag Ted Shoulder Ted Baker Shoulder Agentah Agentah bordeaux red Bag qU76Yw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • BagsWomen Handbag Bag Shoulder Tote Leather Stripe Ladies Women Handbags Bags Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Events Failsworth Millinery Deep Millinery Failsworth Navy Bag qPwtx7d8

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shoulder Stripe Bags Ladies Bag Handbags Leather BagsWomen Handbag Tote Women Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Women's Gold Faux Buckle Envelope KL2098 Handbag Suede Grey Bag Purse Evening Clutch Ladies EUwR0Cxqx