Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x for livelawnandprosper.com
Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x

  • Handbag Tote Shoulder Leather Stripe Ladies Handbags BagsWomen Bags Women Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Gabor Gabor 21 Bag Shoulder Grey Fabia Women’s Taupe Women’s P578xqdP

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Shoulder Zeagoo Black Bag body Tassels Fringe Faux Suede Cross Womens n0BwF6qR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Handbags Tote Bags Bag Shoulder Women Ladies BagsWomen Leather Stripe Handbag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Black Lightweight Shoulder Messenger Big Body Multiple Bag Handbag Rainproof Pocket Cross Small Size Zip Women Fabric Shop xYzT7qza

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Handbag Ladies Tote Bags Stripe Bag BagsWomen Shoulder Leather Women Handbags Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Trend Square Fashion Green Patchwork Forest Small Bags Package Shoulder Ms Leather Girl Printing Diagonal SODIAL PU EYq6vxwv